Search Results

You are looking at 1 - 10 of 190 items for :

  • Refine by Access: All Content x
Clear All

proinflammatory cytokines such as interleukin-1β (IL-1β), tumor necrosis factor-α (TNFα), and interferon-γ (IFNγ), 9 as well as increased parathyroid hormone (PTH) levels. 10 A recent study 11 in a rodent CKD model with nonregenerative anemia showed the

Open access
in American Journal of Veterinary Research

Summary

Antisera raised in rabbits against either purified recombinant-derived human tumor necrosis factor (tnf)- α (hutnf) or hutnf peptide-bovine thyroglobulin conjugates were evaluated for anti-equine tnf (eqtnf) activity. Binding and neutralizing anti-eqtnf activities were found in antisera raised against whole hutnf or against either of the peptides containing the N-terminal 15 amino acids of hutnf (hutnf[1-15] and hutnf[1-31]). Anti-eqtnf activity was not detected in antisera raised against hutnf[65-79], hutnf[98-111] or hutnf[124-141] peptides. The addition of excess hutnf[1-15] completely inhibited the ability of anti-hutnf[1-15] to bind eqtnf and reduced by approximately 25% the anti-eqtnf activity of an antiserum raised against whole hutnf. Nonconjugated hutnf[1-15] did not have eqtnf agonist or antagonist activity. Results were consistent with previous structural and functional data implicating the N-terminus of hutnf in receptor binding and indicate that the homologue of hutnf[1-15] on eqtnf may be a potentially important target for neutralizing anti-eqtnf antibodies.

Free access
in American Journal of Veterinary Research

effects of enteric LPS in equine whole blood and monocytes and inhibit LPS-induced expression of mRNA for TNF-α, IL-1B, IL-6, and IL-10 by monocytes. Materials and Methods Horses —A group of 19 adult horses determined to be healthy on the basis of

Full access
in American Journal of Veterinary Research

have been determined. 9,10 Our previous study 11 in which the kinetics of TNF-α and IL-6 in portal and systemic circulations in dogs that underwent CMA occlusion were investigated revealed that the IL-6 was synthesized mainly in remote organs and not

Full access
in American Journal of Veterinary Research

inflammation through different pathways. 7–9 For instance, PARP1 induces release of high mobility group box 1, a proinflammatory mediator that can induce macrophage activation and TNF-α production. 10 Activation of PARP1 is also involved in inflammatory

Full access
in American Journal of Veterinary Research

mammary gland tissue produce immunomodulating factors (eg, TNF-α and ILs) that enhance recruitment of phagocytes from the blood into milk, where they can combat and eliminate invading pathogens. Therefore, the measurement of SCC in milk is used as an

Full access
in American Journal of Veterinary Research

, catecholamines have immunomodulatory properties, most commonly inhibiting LPS-stimulated production of proinflammatory cytokines, including TNF-α, IL-6, and IL-1β, and stimulating production of the anti-inflammatory cytokine IL-10. 3 This effect of

Full access
in American Journal of Veterinary Research

. Endotoxin then binds to receptors on inflammatory cells, which leads to activation of NF-κB and results in formation of proinflammatory mediators, such as TNF-α. 5 Ultimately, systemic manifestations of endotoxemia (such as fever, tachycardia, and

Full access
in American Journal of Veterinary Research

(MMP8), interleukin-10 (IL-10), interferon-γ (IFN-γ), and tumor necrosis factor-α (TNF-α) have been shown to be significantly elevated in the serum of Diversity Outbred mice infected with M.tb compared to noninfected mice, and this research recently

Open access
in American Journal of Veterinary Research

′TTTTCTGCCAGTGCCTCTTT3′), IL-8 (forward, 5′TTGCCTTGGTCTCTTCTTTATTCC3′; reverse, 5′TTCTGTGAGGTAGGATGCTTGCT3′), IL-10 (forward, 5′CCTGGGTTGCCAAGCCCTGTC3′; reverse, 5′ATGCGCTCTTCACCTGCTCC3′), TNF-α (forward, 5′TCTCGAACCCCAAGTGACAAG3′; reverse, 5′GGAGCTGCCCCTCAGCTT3′), IFN

Full access
in American Journal of Veterinary Research