Search Results

You are looking at 1 - 10 of 13 items for :

  • Refine by Access: All Content x
Clear All

understood that major histocompatibility complex (MHC)-mismatched cells are targeted for death by anti-MHC antibodies. 12 , 13 Recent work indicates that TGF-β2 can be used to reduce the MSC cell surface expression of MHC without altering their

Open access
in Journal of the American Veterinary Medical Association

-γ (forward, 5′GAAAAGGAGTCAGAATCTGTTTCGA3′; reverse, 5′TGCAGGCAGGATGACCATTA3′), TGF-β1 (forward, 5′CACCCGCGTGCTAATGGT3′; reverse, 5′GCGGACTTTTCTTGACTTTCTCA3′), TGF-β2 (forward, 5′GACCCCACATCTCCTGCTAA3′; reverse, 5′CACCCAAGATCCCTCTTGAA3′), TGF-β3 (forward, 5

Full access
in American Journal of Veterinary Research

Abstract

Objective—To evaluate the buffy coat and apheresis methods for preparation of platelet concentrates from equine blood by comparing platelet and growth factor concentrations.

Animals—15 mature mixed-breed geldings.

Procedure—Whole blood samples were collected and processed by use of a buffy coat or apheresis method to obtain platelet poor and platelet concentrated fractions. The PCV, WBC count, and platelet count were compared among whole blood samples, platelet poor fractions, concentrates obtained by use of the apheresis method (ie, apheresis platelet concentrates), and concentrates obtained by use of the buffy coat method (ie, buffy coat platelet concentrates). Concentrations of transforming growth factor- β (ie, TGF-β1 and TGF-β2) and insulin-like growth factor were compared between buffy coat and apheresis platelet concentrates.

Results—Platelet concentrations were 8.9-fold and 5.2-fold greater in buffy coat and apheresis platelet concentrates, respectively, compared with whole blood. Platelet concentrations were 13.1-fold greater in filtered apheresis platelet concentrates, compared with whole blood. TGF-β1 concentrations were 2.8- fold and 3.1-fold greater in buffy coat and apheresis platelet concentrates, respectively, and TGF-β1 concentrations were 10.5-fold greater in filtered apheresis platelet concentrates, compared with whole blood. TGF-β2 concentrations were 3.6-fold greater in apheresis platelet concentrates, compared with whole blood. Platelet concentrations correlated with growth factor concentrations across all blood and platelet fractions. White blood cell counts had a significant positive correlation with TGF-β1 concentration in buffy coat platelet concentrates.

Conclusions and Clinical Relevance—Platelets and TGF-β1 can be concentrated reliably from equine blood by use of buffy coat or apheresis methods, without modification of the protocols used for humans. (Am J Vet Res 2004;65:924–930)

Full access
in American Journal of Veterinary Research

degradation in many tissues, including cardiac valves. 19 The TGF-β family of ligands and receptors includes TGF-β, bone morphogenetic proteins, activins, and inhibins. Three major isoforms of TGF-β, designated TGF-β1, TGF-β2, and TGF-β3, are produced in

Full access
in American Journal of Veterinary Research
Author:

that underwent “dual licensing” with IL-1β and TGF-β2 have superior migration, metabolism, and anabolic gene expression. These data support the importance of paracrine signaling in MSC therapy and provide evidence that dual-licensed MSCs may confer

Full access
in Journal of the American Veterinary Medical Association

control bone marrow–derived MSC immunogenicity through methods such as culture with TGF-β2, which has been shown to downregulate MHC expression on the surface of MSCs and prevent MSC cytotoxicity. 36 , 37 Interestingly, TGF-β2 has also recently been shown

Open access
in Journal of the American Veterinary Medical Association

licensing of equine bone marrow–derived MSCs, collagen type V alpha fragments ( COL5A1 , COL5A2 ), IL6 , and IL11 , and various matrix metalloproteinases and tissue inhibitors of matrix metalloproteinases genes were enhanced. 46 Additionally, TGF-β2

Open access
in American Journal of Veterinary Research

TMJ (similar to results reported in studies in humans) found no significant difference in the concentrations of pro-inflammatory (Il-1, IL-6, IL-8, and TNF-α) and anti-inflammatory (TGF-β 1 , TGF-β 2 , and TGF-β 3 ) cytokines and pathological dental

Full access
in American Journal of Veterinary Research

biosynthetic process); CD74 (pathway, positive regulation of neutrophil chemotaxis); and platelet-derived growth factor receptor-α (pathway, platelet degranulation). Within the molecular function category, notable genes identified included TGF-β1 , TGF-β2

Full access
in American Journal of Veterinary Research

. Oxidative stress and TGF-β2 increase heat shock protein 27 expression in human optic nerve head astrocytes . Invest Ophthalmol Vis Sci 2008 ; 49 : 5403 – 5411 . 10.1167/iovs.07-1478 47. Yang J Patil RV Gordon M , et al. T cell subsets and sIL

Full access
in American Journal of Veterinary Research