Search Results

You are looking at 1 - 10 of 99 items for :

  • Refine by Access: All Content x
Clear All

19 Plex kit; Merck Millipore Corporation) that can quantify 19 cytokines (sFas, Flt-3 ligand, GM-CSF, IFN-γ, IL-1β, IL-2, IL-4, IL-6, IL-8, IL-12-p40, IL-13, IL-18, KC, MCP, PDGF-BB, RANTES, SCF, SDF-1, and TNF-α) simultaneously. Exactly 25 μL of each

Open access
in American Journal of Veterinary Research

expression of the neutrophil chemokine, IL-8, in bronchoalveolar cells 3,4 as well as increases in the protein concentration of IL-8 in BALF. 3,5 Other potential sources of IL-8, such as the airway epithelium, have not yet been investigated in horses with

Full access
in American Journal of Veterinary Research

rates. 6–8 Inflammation associated with transfusion results, in part, from the accumulation of cytokines in stored blood products. 1,2 Interleukin-1β, IL-8, and TNF-α are cytokines that increase in concentration in human whole blood and PRBCs during

Full access
in American Journal of Veterinary Research

cartilage catabolism 26 and suppressors of synthesis of new cartilage matrix. 27 Interleukin-1 and TNF-α strongly induce IL-8 production in a broad range of cells. 28–32 The chemokine IL-8 is chemotactic for neutrophils and T lymphocytes 29,33 and

Full access
in American Journal of Veterinary Research

′TTTTCTGCCAGTGCCTCTTT3′), IL-8 (forward, 5′TTGCCTTGGTCTCTTCTTTATTCC3′; reverse, 5′TTCTGTGAGGTAGGATGCTTGCT3′), IL-10 (forward, 5′CCTGGGTTGCCAAGCCCTGTC3′; reverse, 5′ATGCGCTCTTCACCTGCTCC3′), TNF-α (forward, 5′TCTCGAACCCCAAGTGACAAG3′; reverse, 5′GGAGCTGCCCCTCAGCTT3′), IFN

Full access
in American Journal of Veterinary Research

, and IL-8, mRNA was transcribed to cDNA by use of hexamer random primers. Quantitative real-time PCR assays were performed with a green fluorescent dye f in a real-time thermocycler. g The procedure included denaturation (95°C for 2 minutes) and a

Full access
in American Journal of Veterinary Research

these obstructive airway disorders in humans have revealed that pulmonary neutrophilia results from chemokine and cytokine production by airway immune cells and is also a consequence of IL-8, granulocyte-colony stimulating factor, and CXCL1 synthesis by

Full access
in American Journal of Veterinary Research

used in the study, and quantification with external standards was performed with the fluorescent format for SYBR Green I dye, as previously described. 4,5 Primers for IL-1β, TNF-α, IL-6, IL-8, IL-10, MMP-2, MMP-9, ICAM-1, E-selectin, and 4 housekeeping

Full access
in American Journal of Veterinary Research

, interstitial, or bronchial) initiate the inflammatory response. The chemokines IL-8, IL-1β, and CXCL2 are inflammatory mediators; their expressions are upregulated in horses with recurrent airway obstruction, 19 and they could potentially contribute to

Full access
in American Journal of Veterinary Research

, TFF-3, LP, IAP, IL-8, PAF, and ACTG2 have been reported. 5,6,8,9 For instance, in neonatal humans, plasma concentrations of L-FABP are high in the initial stage of NEC, whereas plasma concentrations of I-FABP are high in the advanced stage of NEC. 10

Full access
in American Journal of Veterinary Research