Search Results

You are looking at 1 - 10 of 31 items for :

  • Refine by Access: Open Access articles x
Clear All

proinflammatory cytokines such as interleukin-1β (IL-1β), tumor necrosis factor-α (TNFα), and interferon-γ (IFNγ), 9 as well as increased parathyroid hormone (PTH) levels. 10 A recent study 11 in a rodent CKD model with nonregenerative anemia showed the

Open access
in American Journal of Veterinary Research

(MMP8), interleukin-10 (IL-10), interferon-γ (IFN-γ), and tumor necrosis factor-α (TNF-α) have been shown to be significantly elevated in the serum of Diversity Outbred mice infected with M.tb compared to noninfected mice, and this research recently

Open access
in American Journal of Veterinary Research
Authors and

necrosis factor-α (TNF-α), and interleukin-17A (IL-17A) have a central role in the pathogenesis of pulmonary fibrosis by stimulating fibroblast proliferation and increasing collagen accumulation. 10 – 12 , 17 Haptoglobin (Hp) is a positive (upregulated

Open access
in American Journal of Veterinary Research

necrosis factor-α ( TNFα ), interleukin-6 ( IL-6 ), and housekeeping genes glyceraldehyde 3-phosphate dehydrogenase ( GADPH ) and elongation factor 1- ( EF1α ) were designed by 2 of the investigators (AM, SH) using a commercial tool (Integrated Data

Open access
in American Journal of Veterinary Research

study had the following 3 objectives: (i) to determine whether dogs with CYB5R deficiency have a constitutive proinflammatory phenotype by comparing plasma levels of tumor necrosis factor-α (TNF-α), interleukin-6 (IL-6), interleukin-10 (IL-10), and serum

Open access
in American Journal of Veterinary Research

systemic concentrations of cytokines, which can lead to deleterious effects on immune and organ function and patient outcomes. 3 Tumor necrosis factor-α (TNF-α) and IL-1β are 2 cytokines that are increased early in equine sepsis and are known to contribute

Open access
in American Journal of Veterinary Research

factor-α (TNF-α), which act on specific receptors within or on the surface of the targeted cells leading to inflammation. 1 Cytokines are key molecules that participate in the inflammatory response and act as mediators to facilitate the communication

Open access
in American Journal of Veterinary Research

for the target gene − ΔCt of the calibrator for the target gene. Table 1 The quantitative PCR primer sequences. Sequence (5'–3') Accession number a TNF-α FW CCCCCAGAAGGAAGAGTTTC JF831365 RV

Open access
in American Journal of Veterinary Research

synthesized in response to proinflammatory cytokines such as IL-1, IL-6, and tumor necrosis factor-alpha (TNF-α), primarily in the liver. 8 , 9 Each species also possesses its own unique major, moderate, and minor APPs. The major positive APPs in cats include

Open access
in American Journal of Veterinary Research

-to-cDNA kit; Applied Biosystems) according to the manufacturer's instructions. The primers for tumor necrosis factor-α (TNF-α), interleukin-1β (IL-1β), IL-2, IL-8, IL-33, and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) were used for real-time PCR. The

Open access
in American Journal of Veterinary Research