Search Results

You are looking at 91 - 100 of 193 items for :

  • Refine by Access: All Content x
Clear All

production of anti-inflammatory cytokine interleukin-10 after HBOT, 10,11 and HBOT prevented fever in LPS-treated rabbits by reducing circulating TNF-α and hypothalamic prostaglandin E 2 . 12 In addition, rats repeatedly exposed to HBOT after they were

Full access
in American Journal of Veterinary Research

potent cytokines released by myeloid cells, such as TNFα and IL-1, promotes a cascade of events that results in sequestration of polymorphonuclear leukocytes in tissues and parenchymal dysfunction. 11 Inflammatory responses are beneficial in recognition

Full access
in American Journal of Veterinary Research

used in the study, and quantification with external standards was performed with the fluorescent format for SYBR Green I dye, as previously described. 4,5 Primers for IL-1β, TNF-α, IL-6, IL-8, IL-10, MMP-2, MMP-9, ICAM-1, E-selectin, and 4 housekeeping

Full access
in American Journal of Veterinary Research

administration and 2 and 24 hours after the end of administration. The concentration of TNF-α was measured in serum samples for all blood sample collection times by use of a commercially available kit t to configure an ELISA. The kit contained capture and

Full access
in American Journal of Veterinary Research

for the target gene − ΔCt of the calibrator for the target gene. Table 1 The quantitative PCR primer sequences. Sequence (5'–3') Accession number a TNF-α FW CCCCCAGAAGGAAGAGTTTC JF831365 RV

Open access
in American Journal of Veterinary Research

increases gene expression of IL-1α, IL-1β, IL-6, IL-8, and TNF-α in peripheral blood leukocytes 14 and increases circulating concentrations of IL-6 and TNF-α protein. 15,16 Therefore, it is expected that endotoxemia would contribute to the development of

Full access
in American Journal of Veterinary Research

traps). 9 – 12 Extracellular his-tones bind to toll-like receptors, leading to increased production of proinflammatory cytokines (eg, TNF-α and IL-6). 11 – 13 Moreover, experimental administration of histones to mice and monkeys induces neutrophil

Full access
in American Journal of Veterinary Research

solution, and the other catheter was used for collection of blood samples for a CBC and measurement of glucose, insulin, and TNF-α plasma concentrations. The LPS was administered in the catheter not used for blood sample collection. Insulin preparation

Full access
in American Journal of Veterinary Research

, expressions of mRNA for the proinflammatory cytokines IL-1β, -6, and -8; TNF-α; and PGS can be determined. Interleukin-1β, -6, and -8 and TNF-α modulate acute inflammatory responses. Interleukin-1, like TNF-α, increases neutrophil adhesion to vascular

Full access
in American Journal of Veterinary Research

cells and breakdown of the blood-brain barrier. 10,14 Activated microglia are a major source of proinflammatory cytokines, such as TNF-α and IL-6. 15 These cytokines are associated with neuronal damage in several neurologic disorders, including

Full access
in American Journal of Veterinary Research